| Author |
Message |
![[Post New]](/templates/default/images/icon_minipost_new.gif) 11 Mar 2008 14:37:42 IST
|
|
|
3'-ATGCATGCATGCATGCATGC-5' --------template strand 5'-TACGTACGTACGTACGTACG-3'----------coding strand sequence of RNA transcribed is??
|
Remember Cedric. Remember, if the time should come when you have to make a choice between what is right and what is easy, remember what happened to a boy who was good, and kind, and brave, because he strayed across the path of Lord Voldemort. Remember Cedric Diggory.
Albus Dumbledore
Goblet of Fire, Chapter 37, Page 724
|
|
|
|
11 Mar 2008 22:41:46 IST
|
|
|
arre yaar.......dont tell me koi bhi bio wala online nahin hai!!
|
Remember Cedric. Remember, if the time should come when you have to make a choice between what is right and what is easy, remember what happened to a boy who was good, and kind, and brave, because he strayed across the path of Lord Voldemort. Remember Cedric Diggory.
Albus Dumbledore
Goblet of Fire, Chapter 37, Page 724
|
this reply: 0 points
(with 0 
in 0 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
11 Mar 2008 22:48:56 IST
|
|
|
i think fst of all they w'll uncoil and then rna w'll form using these stands.
|
this reply: 0 points
(with 0
in 0 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
11 Mar 2008 22:56:25 IST
|
|
|
|
this reply: 5 points
(with 1
in 1 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
11 Mar 2008 23:06:37 IST
|
|
|
so it is sme as template strand except thymine will be replaced by uracil??
|
Remember Cedric. Remember, if the time should come when you have to make a choice between what is right and what is easy, remember what happened to a boy who was good, and kind, and brave, because he strayed across the path of Lord Voldemort. Remember Cedric Diggory.
Albus Dumbledore
Goblet of Fire, Chapter 37, Page 724
|
this reply: 0 points
(with 0
in 0 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
11 Mar 2008 23:18:22 IST
|
|
|
er...i think d ans wil be
UACGUACGUACGUACGUACG
|
"Many of the things you can count,dont count....
Many of the things you cant count,really do count...."-Albert Einstein
"The important thing in science is not so much to obtain new facts as to discover new ways of thinking about them"-William Bragg
"An inexplicable fact is infinitely preferable to an incomprehensible mystery"-F. Soddy
RISHIPRATIM MAZUMDAR
NIT DURGAPUR
1ST YEAR,ELECTRONICS AND COMMUNICATIONS
|
this reply: 5 points
(with 1
in 1 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
11 Mar 2008 23:20:29 IST
|
|
|
can u give me the reason!!
|
Remember Cedric. Remember, if the time should come when you have to make a choice between what is right and what is easy, remember what happened to a boy who was good, and kind, and brave, because he strayed across the path of Lord Voldemort. Remember Cedric Diggory.
Albus Dumbledore
Goblet of Fire, Chapter 37, Page 724
|
this reply: 0 points
(with 0
in 0 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
11 Mar 2008 23:25:56 IST
|
|
|
WELL....
u see,the strand in the 3'-5' direction acts as template....
dats coz d enzyme responsibl 4 transcription acts only in 5'-3' direction,i.e. it can make a strand having 5'-3' polarity....
ithus the enzyme acts on the strand havin 3'-5' as a template and makes a complementary strand of polarity 5'-3'
thus,d rna strand dat is made will b identical to the coding strand wid t replaced by u
|
"Many of the things you can count,dont count....
Many of the things you cant count,really do count...."-Albert Einstein
"The important thing in science is not so much to obtain new facts as to discover new ways of thinking about them"-William Bragg
"An inexplicable fact is infinitely preferable to an incomprehensible mystery"-F. Soddy
RISHIPRATIM MAZUMDAR
NIT DURGAPUR
1ST YEAR,ELECTRONICS AND COMMUNICATIONS
|
this reply: 0 points
(with 0
in 0 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
11 Mar 2008 23:47:44 IST
|
|
|
www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html i m sorry ashgirl i didn't c the 3'-5' end . jus c this animation movie every thing w'll be very much clear
|
this reply: 5 points
(with 1
in 1 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
12 Mar 2008 00:51:04 IST
|
|
|
thanx!!
|
Remember Cedric. Remember, if the time should come when you have to make a choice between what is right and what is easy, remember what happened to a boy who was good, and kind, and brave, because he strayed across the path of Lord Voldemort. Remember Cedric Diggory.
Albus Dumbledore
Goblet of Fire, Chapter 37, Page 724
|
this reply: 0 points
(with 0
in 0 votes ) [?]
|
|
You have to be logged on to rate
|
|
|
|
|
Moderation Team
![[Up]](/templates/default/images/icon_up.gif "[Up]"){kind=icon}
